Details

Authors

Value

a set of the miRNA to target gene matches result, a match result network edges with match score as weights

each siRNAHit object in the generated result collection is a match of one miRNA sequence to one target site of the candidate mRNA sequence: the miRNA and the Target property is the sequence id of the small RNA and the target mRNA, the StartSite/EndSite property is the 1-based site location on the target mRNA sequence, and the Expectation property is the match score(the lower the better);

this function returns NULL if the miRNA sequence collection or the target sequence collection is empty, or the input data can not be cast to a fasta sequence collection.

clr value class

• siRNAHit

Examples

 imports "miRNA" from "TRNtoolkit";
 imports "bioseq.fasta" from "seqtoolkit";
 
 let sirna = fasta("UGACGUGACUGACGUGACUGA", attrs = c("demo-miRNA"));
 let genes = read.fasta("candidates.fa");
 
 let psr = miRNA_targets(psRNATarget(), sirna, targets = genes);
 let tfd = miRNA_targets(TargetFinder(), sirna, targets = genes);
 
 let hi_conf = as.data.frame(intersect_targets(psr, tfd)); 
 
 print(hi_conf, max.print = 6);
 
 write.csv(hi_conf, file = "miRNA_targets_high_confidence.csv");